TOOL DEVELOPMENT

Software

 
Judith Berman lab tools
Yeast Mapping Analysis Pipeline (YMAP)

An online webserver for the visualization of yeast genome sequence datasets that provides intuitive maps of aneuploidies and the degree of heterozygosity across all chromosomes.


YMAP detects copy number variations (CNVs) and loss of heterozygosity (LOH) events in eukaryotic genomes.  It produces maps for lab strains with available haplotype maps and for clinical strains (in which a phylogeny is known). If a reference genome is uploaded, it can map chromosomes for additional yeast genomes.

Judith Berman lab tools
diskImageR

A package for R which provides a quantitative, unbiased method to analyze photographs of disk diffusion assays for any microbial species/microbial drug combination.

The method measures the radius of inhibition ("RAD", i.e., resistance) at three different cutoff values (80%, 50% and 20% growth inhibition) as well as two measures of tolerance, the fraction of growth achieved above RAD ("FoG"), and drug sensitivity ("slope", the rate of change from no growth to full growth).

Available on:

Judith Berman lab diskImageR tool
Judith Berman lab tools
ColonyScanalyser

An image analysis tool for measuring microorganism colony growth. ColonyScanalyser will analyse and collate statistical data from agar plate images. It provides fast, high-throughput image processing.

ColonyScanalyser can provide information on colony appearance time, growth parameters (lag time, rate, carrying capacity), growth and appearance time distribution, and colony colour (e.g. staining or other visual indicator)

Available on:

Judith Berman lab ColonyScanalyser tool
Transposon.jpg
Transposon pipeline

A python package that uses machine learning to give genome-wide predictions of essential and non-essential genes for growth in yeast species under a given environmental condition.

The transposon pipeline uses an insertion mutant library generated from in vivo transposon experiments in a yeast species to identify genes important for growth, and infer essentiality of those genes. Training sets using gene essentiality data generated by classical genetic approaches for Saccharomyces cerevisiae and Schizosaccharomyces pombe are combined with this data to identify a core set of orthologs essential in all three yeasts.

Available on:

Transposon library available upon request.

Judith Berma lab transposon tool
 
Judith Berman lab plasmids

Plasmids

Our lab has constructed a series of plasmids that enable tagging of genes at the N- or C- terminus with fluorescent proteins or epitope tags for protein analysis, described in Gerami-Nejad et al., Yeast 2001, 2004, 2009, and 2012, and Microbiology 2013.

Plasmids are available through The Fungal Genetics Stock Center (FGSC)

N-terminal fluorescent protein constructs

Click on maps to see sequence.

pURA3-Pmet3-GFP (pMG1886)
pMG1886_Pmet3-GFP.jpg

Primers (for all):

5' URA3: TCTAGAAGGACCACCTTTGATTG

3' GFP: TTTGTACAATTCATCCATAC

3' to promoter sequence only: CATTTTAATAAACGCGGATCC

pURA3-Pgal1-GFP (pMG1892)
pMG1892_Pgal1-GFP.jpg
pURA3-Ppck1-GFP (pMG1958)
pMG1958_Ppck1-GFP.jpg
As described in Gerami-Nejad et al., Yeast 2012:
pNAT1-Pmet3-GFP (pMG2190)
pMG2190_pNAT1-Met3-GFP.jpg

Primers:

5' NAT1: ATCAAGCTTGCCTCGTCCCCG

3' GFP: TTTGTACAATTCATCCATAC

3" to promoter sequence only: CATTTTAATAAACGCGGATCC

C-terminal fluorescent protein constructs

Click on maps to see sequence.

pCFP-HIS1 (pMG1801)
Judith Berman lab plasmid
pCFP-URA3 (pMG1726)
Judith Berman lab plasmid
pGFP-HIS1 (pMG1646)
Judith Berman lab plasmid
pGFP-URA3 (pMG1602)
Judith Berman lab plasmid
pYFP-HIS1 (pMG1656)
Judith Berman lab plasmid

Primers:

5': GGTGGTGGTTCTAAAGGTGAAGAATTATT

3': GAATTCCGGAATATTTATGAGAAAC

Primers:

5': GGTGGTGGTTCTAAAGGTGAAGAATTATT

3': TCTAGAAGGACCACCTTTGATTG

Primers:

5': GGTGGTGGTTCTAAAGGTGAAGAATTATT

3': GAATTCCGGAATATTTATGAGAAAC

Primers:

5': GGTGGTGGTTCTAAAGGTGAAGAATTATT

3': TCTAGAAGGACCACCTTTGATTG

Primers:

5': GGTGGTGGTTCTAAAGGTGAAGAATTATT

3': GAATTCCGGAATATTTATGAGAAAC

pYFP-URA3 (pMG1648)
Judith Berman lab plasmid

Primers:

5': GGTGGTGGTTCTAAAGGTGAAGAATTATT

3': TCTAGAAGGACCACCTTTGATTG

pHA-URA3 (pMG1874)
Judith Berman lab plasmid
pHA-HIS1 (pMG1921)
Judith Berman lab plasmid
pMYC-URA3 (pMG1905)
Judith Berman lab plasmid
pMYC-HIS1 (pMG2093)
Judith Berman lab plasmid
pGST-URA3 (pMG2083)
Judith Berman lab plasmid
pV5-URA3 (pMG2090)
Judith Berman lab plasmid
pHIS9-URA3 (pMG2051)
Judith Berman lab plasmid
pdsRFP-URA3 (pMG2169)
Judith Berman lab plasmid
pmCherry-URA3 (pMG2254)
Judith Berman lab plasmid

Primers:

5': GGTGGTGGTCGGATCCCCGGGTTAATTAA

3': TCTAGAAGGACCACCTTTGATTG

Primers:

5': GGTGGTGGTCGGATCCCCGGGTTAATTAA

3': GAATTCCGGAATATTTATGAGAAAC

Primers:

5': GGTGGTGGTCGGATCCCCGGGTTAATTAA

3': TCTAGAAGGACCACCTTTGATTG

Primers:

5': GGTGGTGGTCGGATCCCCGGGTTAATTAA

3': GAATTCCGGAATATTTATGAGAAAC

Primers:

5': GGTGGTGGTCGGATCCCCGGGTTAATTAA

3': TCTAGAAGGACCACCTTTGATTG

Primers:

5': GGTGGTGGTGGTAAGCCTATCCCTAACCCTCTC

3': TCTAGAAGGACCACCTTTGATTG

Primers:

5': GGTGGTGGTTTACGCCAAGCTTGGCAC

3': TCTAGAAGGACCACCTTTGATTG

Primers:

5': GGTGGTGGTGATAACACTGAAGATGTTATT

3': TCTAGAAGGACCACCTTTGATTG

Primers:

5': GGTGGTGGTGTTTCAAAAGGTGAAGAAGATAAT

3': TCTAGAAGGACCACCTTTGATTG

As described in Gerami-Nejad et al., Yeast 2012:

pHA-NAT1 (pMG2352)
Judith Berman lab plasmid
pMYC-NAT1 (pMG2353)
Judith Berman lab plasmid
pGFP-NAT1 (pMG2120)
Judith Berman lab plasmid
pRFP-NAT1 (pMG2261)
Judith Berman lab plasmid
pM-Cherry-NAT1 (pMG2343)
Judith Berman lab plasmid

Primers:

5': GGTGGTCGGATCCCCGGGTTAATTAA

3': GTAAAACGACGGCCAGTGAATTC

Primers:

5': GGTGGTCGGATCCCCGGGTTAATTAA

3': GTAAAACGACGGCCAGTGAATTC

Primers:

5': GGTGGTTCTAAAGGTGAAGAATTATTCACTGG

3': GTAAAACGACGGCCAGTGAATTC

Primers:

5': GGTGGTGATAACACTGAAGATGTTATT

3': GTAAAACGACGGCCAGTGAATTC

Primers:

5': GGTGGTGTTTCAAAAGGTGAAGAAGATAAT

3': ACTGGATGGCGGCGTTAGTATC

N- and C-terminal fluorescent protein constructs

Click on maps to see sequence.

pGFP-URA3-GFP (pMG2082)
Judith Berman lab plasmid

Primers:

5': GGTGGTGGTTCTAAAGGTGAAGAATTATT

3': TTTGTACAATTCATCCATAC

As described in Gerami-Nejad et al., Yeast 2012:
pGF-NAT1-FP (pMG2137)
Judith Berman lab plasmid

Primers:

5': GGTGGTTCTAAAGGTGAAGAATTATTCACTGG

3': TTTGTACAATTCATCCATAC

Shuttle vectors

Click on maps to see larger.

As described in Gerami-Nejad et al., Microbiology 2013:

Primers (for all):

5': GTGCCGTAAAGCACTAAATCGG

3': GTTACCTCACTCATTAGGCACCCC

pDUP vector
Judith Berman lab vector
pDUP3*: pDUP vector with NAT1 marker
pDUP4: pDUP vector with URA3 marker
pDUP5: pDUP vector with URPAdpl200 marker
pDIS vector
Judith Berman lab vector
pDIS3*: pDUP vector with NAT1 marker
pDIS4: pDUP vector with URA3 marker
pDIS5: pDUP vector with URPAdpl200 marker

*Available on:

Judith Berman lab addgene site